Skip to main content
Addgene

pCDNA-CRY2-mCh-superPLDx30-P2A-CIBN-CAAX
(Plasmid #188992)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188992 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA3.1
  • Backbone size w/o insert (bp) 5403
  • Total vector size (bp) 9885
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PLD
  • Alt name
    Phospholipase D
  • Species
    Streptomyces PMF
  • Insert Size (bp)
    1527
  • Mutation
    K109R, P245A, G328S, G381V, G429D
  • Promoter CMV
  • Tags / Fusion Proteins
    • CRY2 (N terminal on insert)
    • mCherry (N terminal on insert)
    • P2A (C terminal on insert)
    • CIBN (C terminal on insert)
    • CAAX (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer mCh-S (CGTGGAACAGTACGAACGC)
  • 3′ sequencing primer CIBN-AS (GGTCACCTCCTATAGCTCCATTC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA-CRY2-mCh-superPLDx30-P2A-CIBN-CAAX was a gift from Jeremy Baskin (Addgene plasmid # 188992 ; http://n2t.net/addgene:188992 ; RRID:Addgene_188992)
  • For your References section:

    Activity-based directed evolution of a membrane editor in mammalian cells. Tei R, Bagde SR, Fromme JC, Baskin JM. Nat Chem. 2023 May 22. doi: 10.1038/s41557-023-01214-0. 10.1038/s41557-023-01214-0 PubMed 37217787