-
PurposeCre-dependent viral expression of ChR2(H134R)-mCherry for neuronal excitation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 18916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
| AAV9 | 18916-AAV9 | Viral service discontinued. | $437 | ||
Don’t see the serotype you want?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV2
- Backbone size w/o insert (bp) 5340
-
Vector typeAAV, Cre/Lox ; Adeno-Associated Virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Growth instructionsStbl2 E coli from Invitrogen Grow at 30 degrees in 2xYT media
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameChannelrhodopsin 2-mCherry
-
Alt nameChR2
-
SpeciesChlamydomonas reinhardtii
-
Insert Size (bp)1677
-
MutationH134R
- Promoter CAG
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Spe1 (destroyed during cloning)
- 3′ cloning site Spe1 (destroyed during cloning)
- 5′ sequencing primer CTGTGGCTGCGTGAAAGCCTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byKarl Deisseroth, Stanford University
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: We now recommend the AAV-FLEX-ChR2tdtomato-rev construct. It shows less clumping relative to ChR2 labeled with mCherry.
These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in Stbl2 cells from Invitrogen. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed. The expected patterns can be calculated from the attached sequence.
Information for AAV9 (Catalog # 18916-AAV9) ( Back to top)
Addgene no longer distributes this item. Contact [email protected] for more information.
Viral service discontinued.
Purpose
Ready-to-use AAV9 particles produced from AAV-FLEX-rev-ChR2(H134R)-mCherry (#18916). In addition to the viral particles, you will also receive purified AAV-FLEX-rev-ChR2(H134R)-mCherry plasmid DNA.
CAG-driven, cre-dependent, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume .
- Titer ≥ 1×10¹³ vg/mL
- Pricing $405 USD for preparation of . virus + $32 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Poloxamer 188
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mCherry (Cre-dependent)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-FLEX-rev-ChR2(H134R)-mCherry was a gift from Scott Sternson (Addgene plasmid # 18916 ; http://n2t.net/addgene:18916 ; RRID:Addgene_18916) For viral preps, please replace (Addgene plasmid # 18916) in the above sentence with: (Addgene viral prep # 18916-AAV9) -
For your References section:
A FLEX switch targets Channelrhodopsin-2 to multiple cell types for imaging and long-range circuit mapping. Atasoy D, Aponte Y, Su HH, Sternson SM. J Neurosci. 2008 Jul 9. 28(28):7025-30. 10.1523/JNEUROSCI.1954-08.2008 PubMed 18614669