Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #18917)


Item Catalog # Description Quantity Price (USD)
Plasmid 18917 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV1 18917-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. More Information
AAV9 18917-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5340
  • Vector type
    AAV, Cre/Lox ; Adeno-Associated Virus

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Stbl2 E coli from Invitrogen Grow at 30 degrees in 2xYT media
  • Copy number
    Low Copy


  • Gene/Insert name
    Channelrhodopsin 2-tdtomato
  • Alt name
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
  • Tag / Fusion Protein
    • tdtomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (destroyed during cloning)
  • 3′ cloning site Spe1 (destroyed during cloning)
  • 5′ sequencing primer CTGTGGCTGCGTGAAAGCCTTG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in Stbl2 cells from Invitrogen. Also, to minimize recombination, cells should be cultured at 30 C.

Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.

Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed. The expected patterns can be calculated from the attached sequence. Please see Reviews in the right column for an image of Addgene's digest with these enzymes.

Information for AAV1 (Catalog # 18917-AAV1) ( Back to top )


Ready-to-use AAV1 particles produced from AAV-FLEX-rev-ChR2-tdtomato (#18917). In addition to the viral particles, you will also receive purified AAV-FLEX-rev-ChR2-tdtomato plasmid DNA.

CAG-driven, cre-dependent, channelrhodopsin fused to tdTomato for optogenetic activation. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato (Cre-dependent)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.

Information for AAV9 (Catalog # 18917-AAV9) ( Back to top )


Ready-to-use AAV9 particles produced from AAV-FLEX-rev-ChR2-tdtomato (#18917). In addition to the viral particles, you will also receive purified AAV-FLEX-rev-ChR2-tdtomato plasmid DNA.

CAG-driven, cre-dependent, channelrhodopsin fused to tdTomato for optogenetic activation. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato (Cre-dependent)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-rev-ChR2-tdtomato was a gift from Scott Sternson (Addgene plasmid # 18917 ; ; RRID:Addgene_18917)

    For viral preps, please replace (Addgene plasmid # 18917) in the above sentence with: (Addgene viral prep # 18917-AAV1) or (Addgene viral prep # 18917-AAV9)

  • For your References section:

    A FLEX switch targets Channelrhodopsin-2 to multiple cell types for imaging and long-range circuit mapping. Atasoy D, Aponte Y, Su HH, Sternson SM. J Neurosci. 2008 Jul 9. 28(28):7025-30. 10.1523/JNEUROSCI.1954-08.2008 PubMed 18614669