Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-FLEX-rev-ChR2(H134R)-mCherry
(Plasmid #18916)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 18916 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV1 18916-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid.
$405
AAV9 18916-AAV9 Viral service discontinued.
$405

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV2
  • Backbone size w/o insert (bp) 5340
  • Vector type
    AAV, Cre/Lox ; Adeno-Associated Virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Stbl2 E coli from Invitrogen Grow at 30 degrees in 2xYT media
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Channelrhodopsin 2-mCherry
  • Alt name
    ChR2
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
    1677
  • Mutation
    H134R
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (destroyed during cloning)
  • 3′ cloning site Spe1 (destroyed during cloning)
  • 5′ sequencing primer CTGTGGCTGCGTGAAAGCCTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: We now recommend the AAV-FLEX-ChR2tdtomato-rev construct. It shows less clumping relative to ChR2 labeled with mCherry.

These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in Stbl2 cells from Invitrogen. Also, to minimize recombination, cells should be cultured at 30 C.

Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.

Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed. The expected patterns can be calculated from the attached sequence.

Information for AAV1 (Catalog # 18916-AAV1) ( Back to top )

Purpose

Ready-to-use AAV1 particles produced from AAV-FLEX-rev-ChR2(H134R)-mCherry (#18916). In addition to the viral particles, you will also receive purified AAV-FLEX-rev-ChR2(H134R)-mCherry plasmid DNA.

CAG-driven, cre-dependent, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

Information for AAV9 (Catalog # 18916-AAV9) ( Back to top )

Purpose

Ready-to-use AAV9 particles produced from AAV-FLEX-rev-ChR2(H134R)-mCherry (#18916). In addition to the viral particles, you will also receive purified AAV-FLEX-rev-ChR2(H134R)-mCherry plasmid DNA.

CAG-driven, cre-dependent, humanized channelrhodopsin H134R mutant fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume .
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of . virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-rev-ChR2(H134R)-mCherry was a gift from Scott Sternson (Addgene plasmid # 18916 ; http://n2t.net/addgene:18916 ; RRID:Addgene_18916)

    For viral preps, please replace (Addgene plasmid # 18916) in the above sentence with: (Addgene viral prep # 18916-AAV1) or (Addgene viral prep # 18916-AAV9)

  • For your References section:

    A FLEX switch targets Channelrhodopsin-2 to multiple cell types for imaging and long-range circuit mapping. Atasoy D, Aponte Y, Su HH, Sternson SM. J Neurosci. 2008 Jul 9. 28(28):7025-30. 10.1523/JNEUROSCI.1954-08.2008 PubMed 18614669