pAAV-hSyn-DIO-Gluc-RMA-IRES-EGFP
(Plasmid
#189630)
-
PurposeExpresses Gluc-RMA and EGFP in the presence of Cre recombinase. Double-floxed Gluc-RMA and EGFP for monitoring Cre-expressing neuronal populations.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189630 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4813
- Total vector size (bp) 7340
-
Vector typeMammalian Expression, AAV, Cre/Lox, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameGaussia luciferase fused to Fc
-
Alt nameGluc-mouse IgG1 Fc
-
Alt nameGluc-RMA
-
SpeciesM. musculus (mouse), Synthetic; Gaussia princeps
- Promoter hSyn
-
Tags
/ Fusion Proteins
- Gluc (N terminal on insert)
- IgG1 Fc (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer catagcgtaaaaggagcaaca (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameIRES-EGFP
- Promoter IRES
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tcagcgctgcctcagtct (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Gluc is derived from AAV-hSyn-GlucM23-iChloC-EYFP (Addgene #114102).
IgG1 is derived from SI4-Jamc.2 (Addgene #28216).
IRES-EGFP is derived from pAAV.CMV.Luc.IRES.EGFP.SV40 (Addgene #105533).
DIO (double-floxed inverted orientation) backbone is derived from pAAV-hSyn-DIO-EGFP (Addgene #50457).
Please visit https://www.biorxiv.org/content/10.1101/2022.07.17.500352v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DIO-Gluc-RMA-IRES-EGFP was a gift from Jerzy Szablowski (Addgene plasmid # 189630 ; http://n2t.net/addgene:189630 ; RRID:Addgene_189630) -
For your References section:
Engineered serum markers for non-invasive monitoring of gene expression in the brain. Lee S, Nouraein S, Kwon JJ, Huang Z, Wojick JA, Xia B, Corder G, Szablowski JO. Nat Biotechnol. 2024 Jan 10. doi: 10.1038/s41587-023-02087-x. 10.1038/s41587-023-02087-x PubMed 38200117