-
PurposeAAV genome encoding SauriABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemodified pX601
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSauriABE8e
-
Alt nameJRD376
-
Insert Size (bp)3834
-
MutationSauriCas9 D15A
- Promoter EFS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGAACCGTATATAAGTGCAG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-EFS-SauriABE8e-bGH-U6-sgRNA-BsmBI was a gift from David Liu (Addgene plasmid # 189925 ; http://n2t.net/addgene:189925 ; RRID:Addgene_189925) -
For your References section:
Efficient in vivo base editing via single adeno-associated viruses with size-optimized genomes encoding compact adenine base editors. Davis JR, Wang X, Witte IP, Huang TP, Levy JM, Raguram A, Banskota S, Seidah NG, Musunuru K, Liu DR. Nat Biomed Eng. 2022 Jul 28. pii: 10.1038/s41551-022-00911-4. doi: 10.1038/s41551-022-00911-4. 10.1038/s41551-022-00911-4 PubMed 35902773