-
PurposePlasmid encoding CjABE8e driven by the CMV promoter for plasmid transfection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV with a BR322 origin
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCjABE8e
-
Insert Size (bp)3663
-
MutationCjCas9 D8A
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGTCGTAACAACTCCGCCCCATTGA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-CjABE8e was a gift from David Liu (Addgene plasmid # 189929 ; http://n2t.net/addgene:189929 ; RRID:Addgene_189929) -
For your References section:
Efficient in vivo base editing via single adeno-associated viruses with size-optimized genomes encoding compact adenine base editors. Davis JR, Wang X, Witte IP, Huang TP, Levy JM, Raguram A, Banskota S, Seidah NG, Musunuru K, Liu DR. Nat Biomed Eng. 2022 Jul 28. pii: 10.1038/s41551-022-00911-4. doi: 10.1038/s41551-022-00911-4. 10.1038/s41551-022-00911-4 PubMed 35902773