pLentiCriprV2-sgRNA-PER1-#2
(Plasmid
#189988)
-
PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189988 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerZhang lab, addgene #52961
- Backbone size w/o insert (bp) 14873
- Total vector size (bp) 13013
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsOnly amplify in RecA- bacteria
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePeriod1
-
gRNA/shRNA sequenceTAGGAGAAGAAAGCCTCTCA
-
SpeciesH. sapiens (human)
-
Entrez GenePER1 (a.k.a. PER, RIGUI, hPER)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BmBI (destroyed during cloning)
- 3′ cloning site BmBI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer --
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2024.02.06.579141v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCriprV2-sgRNA-PER1-#2 was a gift from Achim Kramer (Addgene plasmid # 189988 ; http://n2t.net/addgene:189988 ; RRID:Addgene_189988) -
For your References section:
Circadian period is compensated for repressor protein turnover rates in single cells. Gabriel CH, Del Olmo M, Rizki Widini A, Roshanbin R, Woyde J, Hamza E, Gutu NN, Zehtabian A, Ewers H, Granada A, Herzel H, Kramer A. Proc Natl Acad Sci U S A. 2024 Aug 20;121(34):e2404738121. doi: 10.1073/pnas.2404738121. Epub 2024 Aug 14. 10.1073/pnas.2404738121 PubMed 39141353