pPB-PGK-mCherry.OVA(323-339)
(Plasmid
#190005)
-
PurposePiggybac construct for constitutive expression of mCherry and Chicken Ovalbumin OVA323-339 peptide fusion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190005 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPB-PGK-destination
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 9194
- Total vector size (bp) 8337
-
Vector typeMammalian Expression, Synthetic Biology ; PiggyBac
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry.OVA(323-339)
-
Alt namemCherry, OTII peptide
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)847
- Promoter CAG
-
Tag
/ Fusion Protein
- OVA(323-339) (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-PGK-mCherry.OVA(323-339) was a gift from Siyuan Zhang (Addgene plasmid # 190005 ; http://n2t.net/addgene:190005 ; RRID:Addgene_190005)