Skip to main content

pCAG-WIPI2d (FRRG/AAAA)-TS
(Plasmid #190037)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190037 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    WIPI2d
  • Alt name
    wipi2d (FRRG to AAA)-TEVsite-two strep tag
  • Species
    H. sapiens (human)
  • Mutation
    223FRRG to AAAA
  • GenBank ID
    AM392901.1
  • Entrez Gene
    WIPI2 (a.k.a. ATG18B, Atg21, CGI-50, IDDSSA, WIPI-2)
  • Promoter CMV
  • Tag / Fusion Protein
    • TEV-2xStrep tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (unknown if destroyed)
  • 3′ cloning site XmaI (unknown if destroyed)
  • 5′ sequencing primer 5'- CTTCTTCTTTTTCCTACAGCTCCTGGGC
  • 3′ sequencing primer 5'- gagccagggcattggccacac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-WIPI2d (FRRG/AAAA)-TS was a gift from James Hurley (Addgene plasmid # 190037 ; http://n2t.net/addgene:190037 ; RRID:Addgene_190037)
  • For your References section:

    A PI3K-WIPI2 positive feedback loop allosterically activates LC3 lipidation in autophagy. Fracchiolla D, Chang C, Hurley JH, Martens S. J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098. 10.1083/jcb.201912098 PubMed 32437499