Skip to main content

CMV:eGFP-p2A-HA-GPR151(p.Arg95Ter)
(Plasmid #190134)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190134 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CMV:eGFP-p2A-HA-β2Ar-uTEV1Δ(220-242)
  • Backbone size w/o insert (bp) 7500
  • Total vector size (bp) 8837
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    eGFP-p2A-HA-GPR151(p.Arg95Ter)
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1259
  • Mutation
    p.Arg95Ter mutation
  • GenBank ID
    AB083592.1
  • Promoter CMV
  • Tags / Fusion Proteins
    • eGFP (N terminal on insert)
    • p2A (N terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer CATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV:eGFP-p2A-HA-GPR151(p.Arg95Ter) was a gift from Joshua Knowles (Addgene plasmid # 190134 ; http://n2t.net/addgene:190134 ; RRID:Addgene_190134)
  • For your References section:

    G protein-coupled receptor 151 regulates glucose metabolism and hepatic gluconeogenesis. Bielczyk-Maczynska E, Zhao M, Zushin PH, Schnurr TM, Kim HJ, Li J, Nallagatla P, Sangwung P, Park CY, Cornn C, Stahl A, Svensson KJ, Knowles JW. Nat Commun. 2022 Dec 1;13(1):7408. doi: 10.1038/s41467-022-35069-9. 10.1038/s41467-022-35069-9 PubMed 36456565