-
PurposeExpresses membrane-targeted EGFP in oligodendrocytes; AAV vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepBZ-167 AAV CMV promoter base vector
-
Backbone manufacturerZuchero lab
- Backbone size w/o insert (bp) 4561
- Total vector size (bp) 5640
-
Modifications to backboneRemoved CMV promoter, replaced with MBP promoter for oligodendrocyte expression (Gow...Lazzarini 1991, PMID:1383235)
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsDue to repetitive elements (AAV ITRs) we propagate using recombination-deficient bacteria, eg Stabl3 or NEB Stable. Alternatively it may be possible to use a standard bacterial strain and grow at 30C for longer, which may reduce recombination. Always fully sequence after propagation.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-caax
-
Alt nameEGFP-farnesyl tag
-
SpeciesSynthetic
-
Insert Size (bp)792
- Promoter MBP
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCCTCTTTTCCCGAGATG
- 3′ sequencing primer TATTAGGACAAGGCTGGTGGGCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byEGFP-caax was derived from a plasmid constructed by Trent Watkins and Ben Barres
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PMID: 19038214.
Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV_pMBP-EGFP-caax was a gift from Brad Zuchero (Addgene plasmid # 190155 ; http://n2t.net/addgene:190155 ; RRID:Addgene_190155) -
For your References section:
CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes. Lam M, Takeo K, Almeida RG, Cooper MH, Wu K, Iyer M, Kantarci H, Zuchero JB. Nat Commun. 2022 Sep 23;13(1):5583. doi: 10.1038/s41467-022-33200-4. 10.1038/s41467-022-33200-4 PubMed 36151203