Skip to main content

AAV_pMBP-EGFP-caax
(Plasmid #190155)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190155 Standard format: Plasmid sent in bacteria as agar stab 1 $89
AAV1 190155-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $1032

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pBZ-167 AAV CMV promoter base vector
  • Backbone manufacturer
    Zuchero lab
  • Backbone size w/o insert (bp) 4561
  • Total vector size (bp) 5640
  • Modifications to backbone
    Removed CMV promoter, replaced with MBP promoter for oligodendrocyte expression (Gow...Lazzarini 1991, PMID:1383235)
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Due to repetitive elements (AAV ITRs) we propagate using recombination-deficient bacteria, eg Stabl3 or NEB Stable. Alternatively it may be possible to use a standard bacterial strain and grow at 30C for longer, which may reduce recombination. Always fully sequence after propagation.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP-caax
  • Alt name
    EGFP-farnesyl tag
  • Species
    Synthetic
  • Insert Size (bp)
    792
  • Promoter MBP

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCCTCTTTTCCCGAGATG
  • 3′ sequencing primer TATTAGGACAAGGCTGGTGGGCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PMID: 19038214.

Please visit https://www.biorxiv.org/content/10.1101/2022.07.08.498895v1 for bioRxiv preprint.

Information for AAV1 (Catalog # 190155-AAV1) ( Back to top)

Purpose

Ready-to-use AAV1 particles produced from AAV_pMBP-EGFP-caax (#190155). In addition to the viral particles, you will also receive purified AAV_pMBP-EGFP-caax plasmid DNA.

MBP-driven EGFP expression in oligodendrocytes. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $1000 USD for preparation of 100 µL virus + $32 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_pMBP-EGFP-caax was a gift from Brad Zuchero (Addgene plasmid # 190155 ; http://n2t.net/addgene:190155 ; RRID:Addgene_190155) For viral preps, please replace (Addgene plasmid # 190155) in the above sentence with: (Addgene viral prep # 190155-AAV1)
  • For your References section:

    CNS myelination requires VAMP2/3-mediated membrane expansion in oligodendrocytes. Lam M, Takeo K, Almeida RG, Cooper MH, Wu K, Iyer M, Kantarci H, Zuchero JB. Nat Commun. 2022 Sep 23;13(1):5583. doi: 10.1038/s41467-022-33200-4. 10.1038/s41467-022-33200-4 PubMed 36151203