-
PurposeExpresses EB3-GFP in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190164 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech, Palo Alto, CA
- Backbone size w/o insert (bp) 3986
- Total vector size (bp) 5570
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEB3-GFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1584
-
GenBank IDNM_001303050.2
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGATTTCCAAGTCTCCACCCC
- 3′ sequencing primer GGGAGGTGTGGGAGGTT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EB3-GFP was a gift from Anna Akhmanova (Addgene plasmid # 190164 ; http://n2t.net/addgene:190164 ; RRID:Addgene_190164) -
For your References section:
Visualization of microtubule growth in cultured neurons via the use of EB3-GFP (end-binding protein 3-green fluorescent protein). Stepanova T, Slemmer J, Hoogenraad CC, Lansbergen G, Dortland B, De Zeeuw CI, Grosveld F, van Cappellen G, Akhmanova A, Galjart N. J Neurosci. 2003 Apr 1;23(7):2655-64. PubMed 12684451