Skip to main content

EB3-GFP
(Plasmid #190164)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190164 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 190164-D50 50 μg of DNA in Tris buffer $495
DNA 190164-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech, Palo Alto, CA
  • Backbone size w/o insert (bp) 3986
  • Total vector size (bp) 5570
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EB3-GFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1584
  • GenBank ID
    NM_001303050.2
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGGATTTCCAAGTCTCCACCCC
  • 3′ sequencing primer GGGAGGTGTGGGAGGTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EB3-GFP was a gift from Anna Akhmanova (Addgene plasmid # 190164 ; http://n2t.net/addgene:190164 ; RRID:Addgene_190164)
  • For your References section:

    Visualization of microtubule growth in cultured neurons via the use of EB3-GFP (end-binding protein 3-green fluorescent protein). Stepanova T, Slemmer J, Hoogenraad CC, Lansbergen G, Dortland B, De Zeeuw CI, Grosveld F, van Cappellen G, Akhmanova A, Galjart N. J Neurosci. 2003 Apr 1;23(7):2655-64. PubMed 12684451