-
PurposeExpresses SspBmicro-mCh-p60, a recruitable katanin for microtubule severing, in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepB80
-
Backbone manufacturerLukas Kapitein lab
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 8487
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSspBmicro-mCherry-p60
-
Alt nameSspB-mCh-p60
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)2751
-
GenBank IDNM_011835.3
-
Tag
/ Fusion Protein
- SspBmicro-mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcttctggcgtgtgaccggcgg
- 3′ sequencing primer cctcccacacctccccctgaacct (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SspBmicro-mCh-p60 was a gift from Anna Akhmanova (Addgene plasmid # 190168 ; http://n2t.net/addgene:190168 ; RRID:Addgene_190168) -
For your References section:
Opto-katanin, an optogenetic tool for localized, microtubule disassembly. Meiring JCM, Grigoriev I, Nijenhuis W, Kapitein LC, Akhmanova A. Curr Biol. 2022 Nov 7;32(21):4660-4674.e6. doi: 10.1016/j.cub.2022.09.010. Epub 2022 Sep 28. 10.1016/j.cub.2022.09.010 PubMed 36174574