pXJ40-GFP-iBox-PAK4cat
(Plasmid
#190179)
-
Purposeexpresses GFP-tagged iBox-PAK4cat
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190179 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepXJ40
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-iBox-PAK4cat
-
Alt nameINKA-box-PAK4 catalytic domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1791
- Promoter CMV
-
Tags
/ Fusion Proteins
- Flag (N terminal on insert)
- GFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGAGTAAAGGAGAAGAACTTTTCAC
- 3′ sequencing primer TCATCTGGTGCGGTTCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXJ40-GFP-iBox-PAK4cat was a gift from Bianxiao Cui (Addgene plasmid # 190179 ; http://n2t.net/addgene:190179 ; RRID:Addgene_190179) -
For your References section:
Engineering a Genetically Encoded Magnetic Protein Crystal. Li TL, Wang Z, You H, Ong Q, Varanasi VJ, Dong M, Lu B, Pasca SP, Cui B. Nano Lett. 2019 Oct 9;19(10):6955-6963. doi: 10.1021/acs.nanolett.9b02266. Epub 2019 Sep 25. 10.1021/acs.nanolett.9b02266 PubMed 31552740