Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET-Duet1-6xHis-TEV-LC3BGlydelta5C
(Plasmid #190237)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 190237 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET Duet1
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 5780
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MAP1LC3B
  • Alt name
    LC3B
  • Alt name
    ATG8F
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    360
  • GenBank ID
    NC_000016.10
  • Entrez Gene
    MAP1LC3B (a.k.a. ATG8F, LC3B, MAP1A/1BLC3, MAP1LC3B-a)
  • Tag / Fusion Protein
    • 6xHis-TEV (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGCGTCCGGCGTAGA
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-Duet1-6xHis-TEV-LC3BGlydelta5C was a gift from Sascha Martens (Addgene plasmid # 190237 ; http://n2t.net/addgene:190237 ; RRID:Addgene_190237)
  • For your References section:

    A PI3K-WIPI2 positive feedback loop allosterically activates LC3 lipidation in autophagy. Fracchiolla D, Chang C, Hurley JH, Martens S. J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098. 10.1083/jcb.201912098 PubMed 32437499