Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSelect-2
(Plasmid #190242)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 190242 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSKunk-BLA
  • Total vector size (bp) 5262
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LacI
  • gRNA/shRNA sequence
    gctggcctggttcaccacgc
  • Species
    E. coli

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    gRNA obtatined from pgRNA (Addgene #44251), LacI from pMJ842 (Addgene #39318), and backbone derived from pSKunk-BLA (Addgene #61531).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSelect-2 was a gift from Marc Ostermeier (Addgene plasmid # 190242 ; http://n2t.net/addgene:190242 ; RRID:Addgene_190242)
  • For your References section:

    A bacterial dual positive and negative selection system for dCas9 activity. Spisak S, O'Brien B, Ostermeier M. PLoS One. 2022 Jun 3;17(6):e0269270. doi: 10.1371/journal.pone.0269270. eCollection 2022. 10.1371/journal.pone.0269270 PubMed 35657952