Flag-hTEX14
(Plasmid
#190430)
-
PurposeExpresses Flag-tagged human TEX14 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCD-betaG-FLAG
- Backbone size w/o insert (bp) 4118
- Total vector size (bp) 8590
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTEX14
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4476
-
Entrez GeneTEX14 (a.k.a. CT113, SPGF23)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-hTEX14 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 190430 ; http://n2t.net/addgene:190430 ; RRID:Addgene_190430)