pmCherry-C1-MKLP1
(Plasmid #70154)

• Purpose: mammalian expression of MKLP1 with an mCherry fusion
• Depositing Lab: Masanori Mishima
• Publication: Joseph et al EMBO J. 2012 May 30;31(11):2604-14. doi: 10.1038/emboj.2012.139. Epub 2012 May 11.

Backbone

• Vector backbone: pmCherry-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4722
• Total vector size (bp): 7274
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MKLP1
• Alt name: kinesin family member 23
• Alt name: KIF23
• Species: H. sapiens (human)
• Insert Size (bp): 2574
• Entrez Gene: KIF23 (a.k.a. CDA3, CDAIII, CDAN3, CDAN3A, CHO1, KNSL5, MKLP-1, MKLP1)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: Cherry-F ccccgtaatgcagaagaaga
• 3′ sequencing primer: SV40pA-R

Resource Information

• Supplemental Documents:
  • pmCherry-C1-MKLP1 ape file
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that there are two silent mutations at position 2673 and 4203. The former is an artificial SalI site and the latter a polymorphism (I think). They also have Gly (GGG) artificially inserted between the starting methionine and the lysine 2.