pSPL3-hRPH3A_c.1853Gmut
(Plasmid
#190479)
-
Purposeminigene assay
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190479 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePspl3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRPH3A (NM_014954.3) c.1853 [exon 20 and part of surrounding introns only]
-
SpeciesH. sapiens (human)
-
Insert Size (bp)382
-
Mutationc.1853A>G
-
Entrez GeneRPH3A
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site BamH (unknown if destroyed)
- 5′ sequencing primer TCTGAGTCACCTGGACAACC
- 3′ sequencing primer ATCTCAGTGGTATTTGTGAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSPL3-hRPH3A_c.1853Gmut was a gift from Alfredo Brusco (Addgene plasmid # 190479 ; http://n2t.net/addgene:190479 ; RRID:Addgene_190479) -
For your References section:
Missense variants in RPH3A cause defects in excitatory synaptic function and are associated with a clinically variable neurodevelopmental disorder. Pavinato L, Stanic J, Barzasi M, Gurgone A, Chiantia G, Cipriani V, Eberini I, Palazzolo L, Di Luca M, Costa A, Marcantoni A, Biamino E, Spada M, Hiatt SM, Kelley WV, Vestito L, Sisodiya SM, Efthymiou S, Chand P, Kaiyrzhanov R, Bruselles A, Cardaropoli S, Tartaglia M, De Rubeis S, Buxbaum JD, Smedley D, Ferrero GB, Giustetto M, Gardoni F, Brusco A. Genet Med. 2023 Nov;25(11):100922. doi: 10.1016/j.gim.2023.100922. Epub 2023 Jul 1. 10.1016/j.gim.2023.100922 PubMed 37403762