pUb-Cas9-mCherry_cU6:6-sgRNA
(Plasmid #190598)

• Purpose: The plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoter
• Depositing Lab: Claudia Rueckert
• Depositing Organization: University of Nevada, Reno
  Located in the United States of America
• Publication: Torres et al Insects. 2022 Sep 19;13(9):856. doi: 10.3390/insects13090856.

Backbone

• Vector backbone: Self-assembly from various sources
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 10296
• Vector type: CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4101
• Promoter: Aedes aegypti polyubiquitin
• Tag / Fusion Protein:
  • mCherry - separated by T2A (C terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcaaacgcagacaaagcaaa

Gene/Insert 2

• Gene/Insert name: sgRNA
• Insert Size (bp): 21
• Promoter: Culex quinquefasciatus U6:6

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggatcttgaaaagcacgtcccg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid was cloned from multiple sources: Ae. aegypti polyubiquitin promoter-driven Cas9 from Addgene plasmid #162163 Cx. quinquefasciatus RNA Pol III U6:6 promoter-driven sgRNA cloning site from Feng et al. 2021 kindly provided by Dr. Valentino Gantz (then adapted by our lab for BspQI cloning)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 190598-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 190598-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.