Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSL1180-HR-Aag2-loxP-PUb-RFP-loxP-3xFLAG-AGO1
(Plasmid #162164)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 162164 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSL1180
  • Backbone manufacturer
    Amersham
  • Total vector size (bp) 7782
  • Vector type
    Insect Expression, Cre/Lox, CRISPR ; Homology donor template

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    RFP
  • Species
    Synthetic
  • Insert Size (bp)
    693
  • Promoter Ae. aegypti PUb

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    3xFLAG
  • Species
    Synthetic
  • Insert Size (bp)
    63
  • Promoter endogenous AGO1
  • Tags / Fusion Proteins
    • loxP (N terminal on insert)
    • loxP (C terminal on insert)
    • AGO1 homology (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TACCTGCACTGCTCCTTCAA
  • 3′ sequencing primer AGAGACGAGAGGGAGGAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The BioRxiv pre-print is available at: https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1. Please note that Addgene's full sequence result shows the C-terminal Aag2 HA sequence differs from the depositor's sequence but does not alter the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSL1180-HR-Aag2-loxP-PUb-RFP-loxP-3xFLAG-AGO1 was a gift from Charles Rice (Addgene plasmid # 162164 ; http://n2t.net/addgene:162164 ; RRID:Addgene_162164)
  • For your References section:

    A selectable, plasmid-based system to generate CRISPR/Cas9 gene edited and knock-in mosquito cell lines. Rozen-Gagnon K, Yi S, Jacobson E, Novack S, Rice CM. Sci Rep. 2021 Jan 12;11(1):736. doi: 10.1038/s41598-020-80436-5. 10.1038/s41598-020-80436-5 PubMed 33436886