pSL1180-HR-Aag2-loxP-PUb-RFP-loxP-3xFLAG-AGO1
(Plasmid #162164)

• Purpose: Selectable homology donor template for Aag2 cell AGO1
• Depositing Lab: Charles Rice
• Publication: Rozen-Gagnon et al Sci Rep. 2021 Jan 12;11(1):736. doi: 10.1038/s41598-020-80436-5.

Backbone

• Vector backbone: pSL1180
• Backbone manufacturer: Amersham
• Total vector size (bp): 7782
• Vector type: Insect Expression, Cre/Lox, CRISPR ; Homology donor template

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: RFP
• Species: Synthetic
• Insert Size (bp): 693
• Promoter: Ae. aegypti PUb

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACGTATTTGCTCCGTCACAT

Gene/Insert 2

• Gene/Insert name: 3xFLAG
• Species: Synthetic
• Insert Size (bp): 63
• Promoter: endogenous AGO1
• Tags / Fusion Proteins:
  • loxP (N terminal on insert)
  • loxP (C terminal on insert)
  • AGO1 homology (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TACCTGCACTGCTCCTTCAA
• 3′ sequencing primer: AGAGACGAGAGGGAGGAAGG

Resource Information

• Supplemental Documents:
  • pSL1180_HR_Aag2Ago1NFLAG_loxpRFP.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The BioRxiv pre-print is available at: https://www.biorxiv.org/content/10.1101/2020.10.09.333641v1. Please note that Addgene's full sequence result shows the C-terminal Aag2 HA sequence differs from the depositor's sequence but does not alter the function of the plasmid.