pSPIH6
(Plasmid
#190676)
-
PurposeE. coli plasmid for single step cloning of SUMO-peptide-intein (SPI) fusion proteins (contains SUMO and His-tagged intein)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTXB1
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 6706
- Total vector size (bp) 7038
-
Modifications to backboneAdded C-terminal hexa-His tag to the Mxe GyrA intein, and a PacI restriction site at the 5' end of the intein sequence (at the 3' end of the inserted His6-SUMO tag)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSmall ubiquitin-like modifier
-
Alt nameHis6-SUMO
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)357
-
MutationNone
-
GenBank IDMT011393.1
- Promoter T7
-
Tag
/ Fusion Protein
- N-terminal His tag (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCATAAACTGCCAGGAATTGGGG
- 3′ sequencing primer CACGGGATTGCCATGCCGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMxe GyrA intein with C-terminal chitin binding domain and His tag
-
SpeciesMycobacterium xenopii
-
Insert Size (bp)798
-
MutationAdded C-terminal his tag
-
GenBank IDMW879740.1
- Promoter T7
-
Tags
/ Fusion Proteins
- Chitin binding domain (C terminal on insert)
- His tag (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGCGAAATTAATACGACTCA
- 3′ sequencing primer ATCCGGATATAGTTCCTCCTTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe His6-SUMO gene is from the Champion™ pET SUMO Expression System (Invitrogen), and the pTXB1 backbone is from New England BioLabs
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please hold for publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSPIH6 was a gift from John Vederas (Addgene plasmid # 190676 ; http://n2t.net/addgene:190676 ; RRID:Addgene_190676) -
For your References section:
Simplified cloning and isolation of peptides from "sandwiched" SUMO-peptide-intein fusion proteins. Lamer T, Vederas JC. BMC Biotechnol. 2023 Apr 5;23(1):11. doi: 10.1186/s12896-023-00779-5. 10.1186/s12896-023-00779-5 PubMed 37020212