Skip to main content

double_sgRNA targeting e1 and e4
(Plasmid #190688)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190688 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 9290
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNAs targeting enhancer 1 and 4 of MYC separately
  • gRNA/shRNA sequence
    GAACCTTCAGGGAAAAGGCTT, GGCTGGCTGGGTCTGGTAGT
  • Species
    H. sapiens (human)
  • GenBank ID
    NG_007161
  • Tags / Fusion Proteins
    • BFP (C terminal on insert)
    • Puromycin (C terminal on insert)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    double_sgRNA targeting e1 and e4 was a gift from Stanley Qi (Addgene plasmid # 190688 ; http://n2t.net/addgene:190688 ; RRID:Addgene_190688)
  • For your References section:

    Nested epistasis enhancer networks for robust genome regulation. Lin X, Liu Y, Liu S, Zhu X, Wu L, Zhu Y, Zhao D, Xu X, Chemparathy A, Wang H, Cao Y, Nakamura M, Noordermeer JN, La Russa M, Wong WH, Zhao K, Qi LS. Science. 2022 Aug 11:eabk3512. doi: 10.1126/science.abk3512. 10.1126/science.abk3512 PubMed 35951677