pSN818
(Plasmid
#190690)
-
PurposeMammalian expression plasmid of anti-kinesin (Mouse). Expresses H2 IgG (heavy chain and light chain).
-
Depositing Lab
-
Sequence Information
-
Sequences (3) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190690 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneP1316-IgG2a
-
Backbone manufacturerGavin Wright, Sanger; Yves Durocher, NRC
- Backbone size w/o insert (bp) 5925
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameanti-kinesin (Mus musculus) recombinant mouse monoclonal antibody; IgG heavy and light chains
-
SpeciesM. musculus (mouse), Synthetic
- Promoter Dual CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgtccactcccaggtccaag
- 3′ sequencing primer agccagaggtcgaggtcggggg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA for anti-kinesin heavy chain antibody was cloned from H2 hybridoma obtained from Dr. George Bloom (University of Virginia). Please cite Pfister et al., JCB, 1989.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
H2 is an anti-kinesin heavy chain monoclonal antibody (Pfister et al., JCB, 1989)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSN818 was a gift from Shinsuke Niwa (Addgene plasmid # 190690 ; http://n2t.net/addgene:190690 ; RRID:Addgene_190690) -
For your References section:
Generation of recombinant and chickenized scFv versions of an anti-kinesin monoclonal antibody H2. Niwa S, Chiba K. Cytoskeleton (Hoboken). 2023 Apr 10. doi: 10.1002/cm.21756. 10.1002/cm.21756 PubMed 37036074