pAc-sgRNA-Cas9.scr_1
(Plasmid
#190703)
-
PurposeExpresses scrambled sgRNA and Cas9-Puro in Drosophila S2 cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190703 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAc-sgRNA-Cas9
-
Backbone manufacturerJi-Long Liu
- Backbone size w/o insert (bp) 10615
- Total vector size (bp) 10635
-
Vector typeInsect Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameScrambled sgRNA 1
-
gRNA/shRNA sequenceCTGGGCTACTCCAGTAAGGA
-
SpeciesD. melanogaster (fly)
- Promoter Drosophila U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer GTTCGACTTGCAGCCTGAAATACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAc-sgRNA-Cas9.scr_1 was a gift from David Bartel (Addgene plasmid # 190703 ; http://n2t.net/addgene:190703 ; RRID:Addgene_190703) -
For your References section:
Endogenous transcripts direct microRNA degradation in Drosophila, and this targeted degradation is required for proper embryonic development. Kingston ER, Blodgett LW, Bartel DP. Mol Cell. 2022 Sep 15. pii: S1097-2765(22)00849-8. doi: 10.1016/j.molcel.2022.08.029. 10.1016/j.molcel.2022.08.029 PubMed 36150386