p27-mVenus reporter (PB)
(Plasmid
#190731)
-
PurposeThe p27 reporter vector, which expresses mVenus-fused, mutant (K–) p27 protein with a defective CDK binding.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePB533A-2
-
Backbone manufacturerSystem Biosciences
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namemVenus
- Promoter EF1α
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ATGGTGAGCAAGGGCGAGGA
- 3′ sequencing primer CCGCttacgtctggcgtcgaa (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namep27
-
Alt nameCDKN1B
-
SpeciesH. sapiens (human)
-
Mutationp27-F62A-F64A
- Promoter EF1α
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer ATGGTGAGCAAGGGCGAGGA
- 3′ sequencing primer CCGCttacgtctggcgtcgaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p27-mVenus reporter (PB) was a gift from Toshiro Sato (Addgene plasmid # 190731 ; http://n2t.net/addgene:190731 ; RRID:Addgene_190731) -
For your References section:
Cell-matrix interface regulates dormancy in human colon cancer stem cells. Ohta Y, Fujii M, Takahashi S, Takano A, Nanki K, Matano M, Hanyu H, Saito M, Shimokawa M, Nishikori S, Hatano Y, Ishii R, Sawada K, Machinaga A, Ikeda W, Imamura T, Sato T. Nature. 2022 Jul 7. pii: 10.1038/s41586-022-05043-y. doi: 10.1038/s41586-022-05043-y. 10.1038/s41586-022-05043-y PubMed 35798028