Skip to main content

p27-mVenus reporter (PB)
(Plasmid #190731)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190731 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PB533A-2
  • Backbone manufacturer
    System Biosciences
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    mVenus
  • Promoter EF1α

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ATGGTGAGCAAGGGCGAGGA
  • 3′ sequencing primer CCGCttacgtctggcgtcgaa
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    p27
  • Alt name
    CDKN1B
  • Species
    H. sapiens (human)
  • Mutation
    p27-F62A-F64A
  • Promoter EF1α

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer ATGGTGAGCAAGGGCGAGGA
  • 3′ sequencing primer CCGCttacgtctggcgtcgaa
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p27-mVenus reporter (PB) was a gift from Toshiro Sato (Addgene plasmid # 190731 ; http://n2t.net/addgene:190731 ; RRID:Addgene_190731)
  • For your References section:

    Cell-matrix interface regulates dormancy in human colon cancer stem cells. Ohta Y, Fujii M, Takahashi S, Takano A, Nanki K, Matano M, Hanyu H, Saito M, Shimokawa M, Nishikori S, Hatano Y, Ishii R, Sawada K, Machinaga A, Ikeda W, Imamura T, Sato T. Nature. 2022 Jul 7. pii: 10.1038/s41586-022-05043-y. doi: 10.1038/s41586-022-05043-y. 10.1038/s41586-022-05043-y PubMed 35798028