pCDH-DCX-TurboID-V5-puro
(Plasmid
#190742)
-
PurposeA lentiviral plasmid encoding DCX fusion to V5-tagged TurboID on microtubules (DCX as the microtubule-targeting tag)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDH-CMV-MCS-EF1-Puro
- Backbone size w/o insert (bp) 7368
- Total vector size (bp) 9563
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDCX-TurboID-V5
-
SpeciesH. sapiens (human); DCX is human doublecortin; TurboID is engineered BirA from E.coli
-
Insert Size (bp)1914
-
GenBank ID
-
Entrez GeneDCX (a.k.a. DBCN, DC, LISX, SCLH, XLIS)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV forward
- 3′ sequencing primer pCDH-Rev (tcggcaattgaacgggtgcctaga) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-DCX-TurboID-V5-puro was a gift from Jeremy Baskin (Addgene plasmid # 190742 ; http://n2t.net/addgene:190742 ; RRID:Addgene_190742) -
For your References section:
Proximity Labeling Reveals Spatial Regulation of the Anaphase-Promoting Complex/Cyclosome by a Microtubule Adaptor. Cao X, Shami Shah A, Sanford EJ, Smolka MB, Baskin JM. ACS Chem Biol. 2022 Aug 11. doi: 10.1021/acschembio.2c00527. 10.1021/acschembio.2c00527 PubMed 35952650