pcDNA3.1_rSERT_WT
(Plasmid
#190743)
-
PurposeFor expression of wild-type rat SERT in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190743 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 7423
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSLC6A4 Serotonin Transporter
-
Alt nameSERT
-
Alt nameSLC6A4
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1959
-
GenBank IDNC_051345 NM_013034.4
-
Entrez GeneSlc6a4 (a.k.a. SERT)
- Promoter CMV
-
Tags
/ Fusion Proteins
- c-myc (N terminal on insert)
- His6 (C terminal on insert)
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGCCAACATGCCAGCATCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byB J Hoffman, Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, MD 20892.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please also see:
Zhang YW, Turk BE, Rudnick G. Control of serotonin transporter phosphorylation by conformational state. Proc Natl Acad Sci U S A. 2016 May 17;113(20):E2776-83. doi: 10.1073/pnas.1603282113. Epub 2016 May 2. PMID: 27140629; PMCID: PMC4878475.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_rSERT_WT was a gift from Gary Rudnick (Addgene plasmid # 190743 ; http://n2t.net/addgene:190743 ; RRID:Addgene_190743) -
For your References section:
Structure-based Discovery of Conformationally Selective Inhibitors of the Serotonin Transporter. Singh I, Seth A, Billesbølle CB, Braz J, Rodriguiz RM, Roy K, Bekele B, Craik V, Huang X, Boytsov D, Lak P, O’Donnell H, Sandtner W, Roth BL, Basbaum AI, Wetsel WC, Manglik A, Shoichet BK, Rudnick G. bioRxiv 2022.06.13.495991 10.1101/2022.06.13.495991 PubMed 11592963