pJEC819
(Plasmid
#190815)
-
PurposeCRISPRa backbone plasmid harboring BbsI sites for easy cloning of sgRNA targeting regions via Golden gate.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190815 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCRISPomyces-2
- Backbone size w/o insert (bp) 6578
- Total vector size (bp) 11420
-
Modifications to backboneCas9 changed to dCas9, with promoter SP30 driving its expression, followed by RiboJ and synthetic RBS SR09.
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-XTEN-rpoA
-
SpeciesSynthetic
-
Insert Size (bp)4842
- Promoter SP30
-
Tag
/ Fusion Protein
- XTEN (linker), followed by the N-terminal domain of the RNA Polymerase alpha subunit of Streptomyces venezuelae (RpoA) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gttcagcaagcgggtcatc
- 3′ sequencing primer ctccaaaaggagcctttaattg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEC819 was a gift from James Chappell (Addgene plasmid # 190815 ; http://n2t.net/addgene:190815 ; RRID:Addgene_190815) -
For your References section:
Activating natural product synthesis using CRISPR interference and activation systems in Streptomyces. Ameruoso A, Villegas Kcam MC, Cohen KP, Chappell J. Nucleic Acids Res. 2022 Jul 22;50(13):7751-7760. doi: 10.1093/nar/gkac556. 10.1093/nar/gkac556 PubMed 35801861