Skip to main content

pJEC819
(Plasmid #190815)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190815 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRISPomyces-2
  • Backbone size w/o insert (bp) 6578
  • Total vector size (bp) 11420
  • Modifications to backbone
    Cas9 changed to dCas9, with promoter SP30 driving its expression, followed by RiboJ and synthetic RBS SR09.
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-XTEN-rpoA
  • Species
    Synthetic
  • Insert Size (bp)
    4842
  • Promoter SP30
  • Tag / Fusion Protein
    • XTEN (linker), followed by the N-terminal domain of the RNA Polymerase alpha subunit of Streptomyces venezuelae (RpoA) (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gttcagcaagcgggtcatc
  • 3′ sequencing primer ctccaaaaggagcctttaattg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJEC819 was a gift from James Chappell (Addgene plasmid # 190815 ; http://n2t.net/addgene:190815 ; RRID:Addgene_190815)
  • For your References section:

    Activating natural product synthesis using CRISPR interference and activation systems in Streptomyces. Ameruoso A, Villegas Kcam MC, Cohen KP, Chappell J. Nucleic Acids Res. 2022 Jul 22;50(13):7751-7760. doi: 10.1093/nar/gkac556. 10.1093/nar/gkac556 PubMed 35801861