pTSK561
(Plasmid
#190816)
-
PurposeFor C-terminal -Halo Tagging of a gene of interest with URA3 selection marker in yeast S. cerevisiae
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190816 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTSK405
- Backbone size w/o insert (bp) 6752
- Total vector size (bp) 7691
-
Vector typeBacterial cloning vector
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag
-
SpeciesBacteria Rhodococcus rhodochrous
-
Insert Size (bp)939
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer cttccctcgatccgcttgag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTSK561 was a gift from Tatiana Karpova & Gunjan Mehta (Addgene plasmid # 190816 ; http://n2t.net/addgene:190816 ; RRID:Addgene_190816) -
For your References section:
Single molecule tracking of Ace1p in Saccharomyces cerevisiae defines a characteristic residence time for non-specific interactions of transcription factors with chromatin. Ball DA, Mehta GD, Salomon-Kent R, Mazza D, Morisaki T, Mueller F, McNally JG, Karpova TS. Nucleic Acids Res. 2016 Dec 1;44(21):e160. doi: 10.1093/nar/gkw744. Epub 2016 Aug 26. 10.1093/nar/gkw744 PubMed 27566148