pGEX-4T1_ATG4B_BamHI_NotI
(Plasmid
#190862)
-
PurposePlasmid for the expression and purification of of ATG4B. Internal reference: SMC1392
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-4T1
-
Backbone manufacturerAmersham
- Backbone size w/o insert (bp) 4969
- Total vector size (bp) 6134
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATG4B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1182
-
GenBank IDNC_000002.12
-
Entrez GeneATG4B (a.k.a. APG4B, AUTL1, HsAPG4B)
-
Tag
/ Fusion Protein
- GST, Thrombin Cleavage site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotHI (not destroyed)
- 5′ sequencing primer TGGCAAGCCACGTTTGGTGG
- 3′ sequencing primer CACCGAAACGCGCGAGGCAG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-4T1_ATG4B_BamHI_NotI was a gift from Sascha Martens (Addgene plasmid # 190862 ; http://n2t.net/addgene:190862 ; RRID:Addgene_190862) -
For your References section:
A PI3K-WIPI2 positive feedback loop allosterically activates LC3 lipidation in autophagy. Fracchiolla D, Chang C, Hurley JH, Martens S. J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098. 10.1083/jcb.201912098 PubMed 32437499