pET-Duet1_6xHis-TEV-GABARAP-Gly
(Plasmid
#190930)
-
PurposePlasmid for the expression and purification of GABARAP. Internal Reference: SMC894
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190930 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET Duet1
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 5787
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGABARAP
-
Alt nameATG8A-a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)348
-
MutationEnds with Glycine 116
-
GenBank IDNC_000017.11
-
Entrez GeneGABARAP (a.k.a. ATG8A, GABARAP-a, MM46)
-
Tag
/ Fusion Protein
- 6xHis-TEV (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATCACCATCATCACCAC
- 3′ sequencing primer GATTATGCGGCCGTGTACAA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-Duet1_6xHis-TEV-GABARAP-Gly was a gift from Sascha Martens (Addgene plasmid # 190930 ; http://n2t.net/addgene:190930 ; RRID:Addgene_190930) -
For your References section:
Reconstitution defines the roles of p62, NBR1 and TAX1BP1 in ubiquitin condensate formation and autophagy initiation. Turco E, Savova A, Gere F, Ferrari L, Romanov J, Schuschnig M, Martens S. Nat Commun. 2021 Sep 1;12(1):5212. doi: 10.1038/s41467-021-25572-w. 10.1038/s41467-021-25572-w PubMed 34471133