pLenti-NRCH-PE2max-BSD
(Plasmid
#191103)
-
PurposeLentiviral expression plasmid of NRCH-PEmax prime editor with P2A-BSD marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-PE2max-BSD
-
Backbone manufacturerHyongbum Kim
- Backbone size w/o insert (bp) 8693
- Total vector size (bp) 15050
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNRCH-PEmax
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6357
-
MutationChanged R221K, N394K, H840A from SpCas9-NRCH
- Promoter EF-1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAAACTGGGAAAGTGATGTCGTGT
- 3′ sequencing primer ggttgcgtcagcaaacacag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-NRCH-PE2max-BSD was a gift from Hyongbum Kim (Addgene plasmid # 191103 ; http://n2t.net/addgene:191103 ; RRID:Addgene_191103) -
For your References section:
Prediction of efficiencies for diverse prime editing systems in multiple cell types. Yu G, Kim HK, Park J, Kwak H, Cheong Y, Kim D, Kim J, Kim J, Kim HH. Cell. 2023 Apr 21:S0092-8674(23)00331-8. doi: 10.1016/j.cell.2023.03.034. 10.1016/j.cell.2023.03.034 PubMed 37119812