Skip to main content

pLenti_gRNA -hMLHdn-Puro
(Plasmid #191105)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191105 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Lenti_gRNA-Puro
  • Backbone manufacturer
    Hyongbum Kim
  • Backbone size w/o insert (bp) 8261
  • Total vector size (bp) 10673
  • Modifications to backbone
    hMLH1dn for MMR knockdown
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hMLH1dn
  • Alt name
    Human MLH1 del754-756 with P2A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2327
  • Mutation
    I31 silent mutation (ATA to ATC) to remove early termination signal
  • Promoter EF-1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer GTGGGCTTGTACTCGGTCAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_gRNA -hMLHdn-Puro was a gift from Hyongbum Kim (Addgene plasmid # 191105 ; http://n2t.net/addgene:191105 ; RRID:Addgene_191105)
  • For your References section:

    Prediction of efficiencies for diverse prime editing systems in multiple cell types. Yu G, Kim HK, Park J, Kwak H, Cheong Y, Kim D, Kim J, Kim J, Kim HH. Cell. 2023 Apr 21:S0092-8674(23)00331-8. doi: 10.1016/j.cell.2023.03.034. 10.1016/j.cell.2023.03.034 PubMed 37119812