mARGAna (cassette 1)
(Plasmid
#191341)
-
PurposeSecond-generation mammalian acoustic reporter gene derived from Anabaena
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePB-CMV-MCS-EF1α-GFP
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 6609
- Total vector size (bp) 8142
-
Modifications to backboneDeleted CMV promotor and MCS
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemARGAna (cassette 1)
-
Alt nameSecond-generation mammalian acoustic reporter gene (cassette 1) on the piggyBac transposon plasmid
-
SpeciesAnabaena flos-aquae (Dolichospermum flos-aquae) CCAP 1403/13F
-
Insert Size (bp)1533
- Promoter TRE3GV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cacggccactagtTTCACTCGAGTTTAC
- 3′ sequencing primer TCACTTGTACAGCTCATCCATGCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2021.04.26.441537v3 bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mARGAna (cassette 1) was a gift from Mikhail Shapiro (Addgene plasmid # 191341 ; http://n2t.net/addgene:191341 ; RRID:Addgene_191341) -
For your References section:
Genomically mined acoustic reporter genes for real-time in vivo monitoring of tumors and tumor-homing bacteria. Hurt RC, Buss MT, Duan M, Wong K, You MY, Sawyer DP, Swift MB, Dutka P, Barturen-Larrea P, Mittelstein DR, Jin Z, Abedi MH, Farhadi A, Deshpande R, Shapiro MG. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01581-y. 10.1038/s41587-022-01581-y PubMed 36593411