pBAD-bARGSer-AxeTxe
(Plasmid #192473)

• Purpose: Second-generation bacterial acoustic reporter gene derived from Serratia
• Depositing Lab: Mikhail Shapiro
• Publication: Hurt et al Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01581-y.

Backbone

• Vector backbone: pBAD33
• Backbone manufacturer: Beckwith Lab
• Backbone size w/o insert (bp): 5352
• Total vector size (bp): 23202
• Modifications to backbone: point mutations introduced during cloning
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: bARGSer
• Alt name: Bacterial acoustic reporter genes originating from Serratia sp. ATCC 39006
• Alt name: Modified gas vesicle gene cluster from Serratia sp. ATCC 39006
• Species: Serratia sp. ATCC 39006
• Insert Size (bp): 16692
• Mutation: the gene Ser39006_001280 was deleted from the cluster, and 3 point mutations were introduced during cloning (GvpG P133P, GvpW P609H, GvpZ D112Y)
• GenBank ID: AWXH00000000.1 AWXH00000000.1
• Promoter: pBAD

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCAATTGTCCATATTGCATC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Gene/Insert 2

• Gene/Insert name: AxeTxe
• Alt name: Toxin-antitoxin system
• Species: Enterococcus faecium
• Insert Size (bp): 1212
• GenBank ID: AF507977.1 AF507977.1
• Promoter: Native promoter from Enterococcus faecium

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTAATGAGGATGCTGAAACAC
• 3′ sequencing primer: AAGCATCATCAGACCAAGCC

Resource Information

• Supplemental Documents:
  • pBAD-bARGSer-AxeTxe (MB29).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit for https://www.biorxiv.org/content/10.1101/2021.04.26.441537v3 bioRxiv preprint.