Skip to main content

pQmod3C-GG
(Plasmid #191350)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191350 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMTL83141
  • Backbone manufacturer
    Chain Biotech
  • Backbone size w/o insert (bp) 3710
  • Total vector size (bp) 4580
  • Modifications to backbone
    drop-out Plac-RFP cassette flanked with BsaI sites
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Plac-RFP (IPTG-inducible red fluorescent protein)
  • Insert Size (bp)
    1103
  • Promoter Plac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer caggaaacagctatgaccgc
  • 3′ sequencing primer cactgttatgccttttgact
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQmod3C-GG was a gift from Andrew Tolonen (Addgene plasmid # 191350 ; http://n2t.net/addgene:191350 ; RRID:Addgene_191350)
  • For your References section:

    Tuning of Gene Expression in Clostridium phytofermentans Using Synthetic Promoters and CRISPRi. Rostain W, Zaplana T, Boutard M, Baum C, Tabuteau S, Sanitha M, Ramya M, Guss A, Ettwiller L, Tolonen AC. ACS Synth Biol. 2022 Dec 16;11(12):4077-4088. doi: 10.1021/acssynbio.2c00385. Epub 2022 Nov 25. 10.1021/acssynbio.2c00385 PubMed 36427328