pQdC12a
(Plasmid
#191356)
-
PurposeClostridium CRISPRi plasmid with TetR-repressible dCas12a (LbCpf1) expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQmod3C-GG
-
Backbone manufacturerTolonen Lab
- Backbone size w/o insert (bp) 4581
- Total vector size (bp) 8290
-
Modifications to backbonePGusA2-TetO2/1 driving expression of dCas12a, miniPthl driving expression of tetR, gRNA cassette for dCas12a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth TemperatureRoom Temperature
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePGusA2-TetO2/1-dCas12a (LbCpf1)
-
SpeciesSynthetic
-
Insert Size (bp)3791
- Promoter PGus2A-TetO2/1
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer caggaaacagctatgaccgc
- 3′ sequencing primer cactgttatgccttttgact
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameminiPthl-tetR
-
Insert Size (bp)728
- Promoter miniPthl
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer acaaggagtggctggagtac
- 3′ sequencing primer ggaagattcgatcgctatgct
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCas12a (LbCpf1) cloned from Addgene 84740
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Clostridium CRISPRi plasmid with TetR-repressible dCas12a (LbCpf1) expression
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQdC12a was a gift from Andrew Tolonen (Addgene plasmid # 191356 ; http://n2t.net/addgene:191356 ; RRID:Addgene_191356) -
For your References section:
Tuning of Gene Expression in Clostridium phytofermentans Using Synthetic Promoters and CRISPRi. Rostain W, Zaplana T, Boutard M, Baum C, Tabuteau S, Sanitha M, Ramya M, Guss A, Ettwiller L, Tolonen AC. ACS Synth Biol. 2022 Dec 16;11(12):4077-4088. doi: 10.1021/acssynbio.2c00385. Epub 2022 Nov 25. 10.1021/acssynbio.2c00385 PubMed 36427328