pcDNA3 Flag-MBD1-14-mVenusC
(Plasmid
#191393)
-
PurposeMBD domain of MBD1 fused to C-terminal part of split mVenus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5440
- Total vector size (bp) 5977
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepcDNA3 Flag-MBD1-14-mVenusC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)535
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAACGGGACTTTCCAAAATGTCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 Flag-MBD1-14-mVenusC was a gift from Albert Jeltsch (Addgene plasmid # 191393 ; http://n2t.net/addgene:191393 ; RRID:Addgene_191393) -
For your References section:
Modular fluorescence complementation sensors for live cell detection of epigenetic signals at endogenous genomic sites. Lungu C, Pinter S, Broche J, Rathert P, Jeltsch A. Nat Commun. 2017 Sep 21;8(1):649. doi: 10.1038/s41467-017-00457-z. 10.1038/s41467-017-00457-z PubMed 28935858