pTH-PanCen TALE-mVenusN
(Plasmid
#191395)
-
PurposeTALE fused to N-terminal part of split mVenus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTH-PanCen TALE
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 8882
-
Vector typeMammalian Expression, TALEN
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameN-terminal part of split mVenus
-
Insert Size (bp)600
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAACGGGACTTTCCAAAATGTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe pTH-PanCen-mVenus plasmid was provided by Prof. Thoru Pederson (Addgene plasmid no. 49640)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTH-PanCen TALE-mVenusN was a gift from Albert Jeltsch (Addgene plasmid # 191395 ; http://n2t.net/addgene:191395 ; RRID:Addgene_191395) -
For your References section:
Modular fluorescence complementation sensors for live cell detection of epigenetic signals at endogenous genomic sites. Lungu C, Pinter S, Broche J, Rathert P, Jeltsch A. Nat Commun. 2017 Sep 21;8(1):649. doi: 10.1038/s41467-017-00457-z. 10.1038/s41467-017-00457-z PubMed 28935858