pSIN-U6-tracer_C9_1_-EF1a-Thy1.1-P2A-Neo
(Plasmid
#191397)
-
PurposesgRNA targeting alpha-satellites on human chromosome 9
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSIN-U6-tracer_sgRNA_-EF1a-Thy1.1-P2A-Neo
- Backbone size w/o insert (bp) 7100
- Total vector size (bp) 7106
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting alpha satellites on human chromosome 9
-
gRNA/shRNA sequenceGTGGAATGGAATGGAATGGA
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGGACTATCATATGCTTACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe sgRNA against the alpha satellite sequence was cloned as described by Ma et al. 2015 "Multicolor CRISPR labeling of chromosomal loci in human cells"
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIN-U6-tracer_C9_1_-EF1a-Thy1.1-P2A-Neo was a gift from Albert Jeltsch (Addgene plasmid # 191397 ; http://n2t.net/addgene:191397 ; RRID:Addgene_191397) -
For your References section:
Modular fluorescence complementation sensors for live cell detection of epigenetic signals at endogenous genomic sites. Lungu C, Pinter S, Broche J, Rathert P, Jeltsch A. Nat Commun. 2017 Sep 21;8(1):649. doi: 10.1038/s41467-017-00457-z. 10.1038/s41467-017-00457-z PubMed 28935858