Skip to main content
Addgene

prCAG-RBS"m1"-sfGFP
(Plasmid #191400)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191400 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRBS"m1"-sfGFP
  • Backbone size w/o insert (bp) 2578
  • Total vector size (bp) 3472
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    47xCAG RBS"m1"-sfGFP
  • Species
    Synthetic
  • Insert Size (bp)
    894
  • Promoter PLtet0-1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TCCGACGAGATGTGGATCGA
  • 3′ sequencing primer GCGTTCACCGACAAACAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    47xCAG repeats: R.Vale (Jain and Vale, 2017) Addgene plasmid # 99148; sfGFP: originally cloned by G.S. Waldo; PMID 16369541

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    prCAG-RBS"m1"-sfGFP was a gift from Ariel Lindner (Addgene plasmid # 191400 ; http://n2t.net/addgene:191400 ; RRID:Addgene_191400)
  • For your References section:

    Spatial engineering of E. coli with addressable phase-separated RNAs. Guo H, Ryan JC, Song X, Mallet A, Zhang M, Pabst V, Decrulle AL, Ejsmont P, Wintermute EH, Lindner AB. Cell. 2022 Sep 29;185(20):3823-3837.e23. doi: 10.1016/j.cell.2022.09.016. 10.1016/j.cell.2022.09.016 PubMed 36179672