prCAG-RBS"m1"-sfGFP
(Plasmid
#191400)
-
PurposeExpression of 47 rCAG repeats fused to a translational unit over-expressing superfolder GFP using a strong RBS. The RBS contains mutation (m1)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRBS"m1"-sfGFP
- Backbone size w/o insert (bp) 2578
- Total vector size (bp) 3472
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name47xCAG RBS"m1"-sfGFP
-
SpeciesSynthetic
-
Insert Size (bp)894
- Promoter PLtet0-1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCCGACGAGATGTGGATCGA
- 3′ sequencing primer GCGTTCACCGACAAACAACA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by47xCAG repeats: R.Vale (Jain and Vale, 2017) Addgene plasmid # 99148; sfGFP: originally cloned by G.S. Waldo; PMID 16369541
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
prCAG-RBS"m1"-sfGFP was a gift from Ariel Lindner (Addgene plasmid # 191400 ; http://n2t.net/addgene:191400 ; RRID:Addgene_191400) -
For your References section:
Spatial engineering of E. coli with addressable phase-separated RNAs. Guo H, Ryan JC, Song X, Mallet A, Zhang M, Pabst V, Decrulle AL, Ejsmont P, Wintermute EH, Lindner AB. Cell. 2022 Sep 29;185(20):3823-3837.e23. doi: 10.1016/j.cell.2022.09.016. 10.1016/j.cell.2022.09.016 PubMed 36179672