prCAG-RBS"m1"-sfGFP
(Plasmid #191400)

• Purpose: Expression of 47 rCAG repeats fused to a translational unit over-expressing superfolder GFP using a strong RBS. The RBS contains mutation (m1)
• Depositing Lab: Ariel Lindner
• Publication: Guo et al Cell. 2022 Sep 29;185(20):3823-3837.e23. doi: 10.1016/j.cell.2022.09.016.

Backbone

• Vector backbone: pRBS"m1"-sfGFP
• Backbone size w/o insert (bp): 2578
• Total vector size (bp): 3472
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 47xCAG RBS"m1"-sfGFP
• Species: Synthetic
• Insert Size (bp): 894
• Promoter: PLtet0-1

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TCCGACGAGATGTGGATCGA
• 3′ sequencing primer: GCGTTCACCGACAAACAACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: 47xCAG repeats: R.Vale (Jain and Vale, 2017) Addgene plasmid # 99148; sfGFP: originally cloned by G.S. Waldo; PMID 16369541

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry