pTFG027_Spike_sACE2-resistant_D614G_F486S_3xFlag
(Plasmid
#191572)
-
PurposeMutated SARS-CoV-2 Spike under CMV with D614G, C-term 19 amino acid truncation, and 3x FLAG. Encodes F486S mutation. For expression and pseudotyping lentiviral particles.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191572 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1/Hygro(+)
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 4305
-
Modifications to backbone1. Beta-globin intron added. 2. See Addgene #138749. Deliberately modified from pcDNA3.1/HygroR(+) in the following ways: SV40 Promoter deleted (but SV40 origin retained), HygroR gene deleted, BsaI site in AmpR mutated, BpiI site in BGH PolyA tail mutated.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 Spike Protein
-
Alt nameSpike
-
SpeciesSynthetic
-
Insert Size (bp)3762
-
MutationD614G and F486S (confers reduced binding affinity to soluble ACE2) mutations. Last 19 amino acids truncated.
-
GenBank ID43740568
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3x FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gctaatagcagctacaatccagctacc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFang Li's lab. Nonmutated Spike sequence cloned from Addgene plasmid #145032.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTFG027_Spike_sACE2-resistant_D614G_F486S_3xFlag was a gift from Joshua Leonard (Addgene plasmid # 191572 ; http://n2t.net/addgene:191572 ; RRID:Addgene_191572) -
For your References section:
Elucidating Design Principles for Engineering Cell-Derived Vesicles to Inhibit SARS-CoV-2 Infection. Gunnels TF, Stranford DM, Mitrut RE, Kamat NP, Leonard JN. Small. 2022 May;18(19):e2200125. doi: 10.1002/smll.202200125. Epub 2022 Apr 7. 10.1002/smll.202200125 PubMed 35388947