Skip to main content
Addgene
Open Menu

EGFP-p300 (D1399Y)
(Plasmid #191763)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191763 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 191763-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 191763-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pIRESpuro2
  • Backbone size w/o insert (bp) 4844
  • Total vector size (bp) 7751
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FRB-EGFP-p300 core (D1399Y)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2907
  • Mutation
    catalytic D1399Y mutation in p300
  • GenBank ID
    NM_001429
  • Entrez Gene
    EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
  • Promoter EF1alpha
  • Tags / Fusion Proteins
    • EGFP (N-terminal of p300 core (D1399Y)) (N terminal on insert)
    • FRB (N-terminal of EGFP) (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAAGTGCAGTAGTCGCCGTGAACGT
  • 3′ sequencing primer CATGCCCGCTTTTGAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-p300 (D1399Y) was a gift from Daniel Gerlich (Addgene plasmid # 191763 ; http://n2t.net/addgene:191763 ; RRID:Addgene_191763)

  • For your References section:

    A mitotic chromatin phase transition prevents perforation by microtubules. Schneider MWG, Gibson BA, Otsuka S, Spicer MFD, Petrovic M, Blaukopf C, Langer CCH, Batty P, Nagaraju T, Doolittle LK, Rosen MK, Gerlich DW. Nature. 2022 Sep;609(7925):183-190. doi: 10.1038/s41586-022-05027-y. Epub 2022 Aug 3. 10.1038/s41586-022-05027-y PubMed 35922507
Related items:
Commonly requested with: