EGFP-p300 (D1399Y)
(Plasmid #191763)

• Purpose: Expression of EGFP fused to catalytically dead core p300 histone acetyltransferase (D1399Y)
• Depositing Lab: Daniel Gerlich
• Publication: Schneider et al Nature. 2022 Sep;609(7925):183-190. doi: 10.1038/s41586-022-05027-y. Epub 2022 Aug 3.

Backbone

• Vector backbone: pIRESpuro2
• Backbone size w/o insert (bp): 4844
• Total vector size (bp): 7751
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: FRB-EGFP-p300 core (D1399Y)
• Species: H. sapiens (human)
• Insert Size (bp): 2907
• Mutation: catalytic D1399Y mutation in p300
• GenBank ID: NM_001429
• Entrez Gene: EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
• Promoter: EF1alpha
• Tags / Fusion Proteins:
  • EGFP (N-terminal of p300 core (D1399Y)) (N terminal on insert)
  • FRB (N-terminal of EGFP) (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAAGTGCAGTAGTCGCCGTGAACGT
• 3′ sequencing primer: CATGCCCGCTTTTGAGA

Resource Information

• Supplemental Documents:
  • EGFP-p300 (D1399Y).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry