pBK-CMV-mpx
(Plasmid
#191826)
-
Purposempx probe generation for in situ
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBK-CMV
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 7625
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namempx cDNA
-
Alt namemyeloperoxidase
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)3108
-
Entrez Genempx (a.k.a. drf, fj80f04, mpo, wu:fj80f04)
- Promoter CMV promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gtaaaacgacggccagt
- 3′ sequencing primer agcggataacaatttcacacagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBK-CMV-mpx was a gift from Jason Berman (Addgene plasmid # 191826 ; http://n2t.net/addgene:191826 ; RRID:Addgene_191826) -
For your References section:
Human JAK1 gain of function causes dysregulated myelopoeisis and severe allergic inflammation. Biggs CM, Cordeiro-Santanach A, Prykhozhij SV, Deveau AP, Lin Y, Del Bel KL, Orben F, Ragotte RJ, Saferali A, Mostafavi S, Dinh L, Dai D, Weinacht KG, Dobbs K, Ott de Bruin L, Sharma M, Tsai K, Priatel JJ, Schreiber RA, Rozmus J, Hosking MC, Shopsowitz KE, McKinnon ML, Vercauteren S, Seear M, Notarangelo LD, Lynn FC, Berman JN, Turvey SE. JCI Insight. 2022 Dec 22;7(24):e150849. doi: 10.1172/jci.insight.150849. 10.1172/jci.insight.150849 PubMed 36546480