pInducer-FRA1
(Plasmid
#192267)
-
PurposeDoxycycline-inducible expression of murine FRA1 (Fosl1)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepInducer20-Blast (Plasmid #109334)
-
Backbone manufacturerJean Cook
- Backbone size w/o insert (bp) 12215
- Total vector size (bp) 11369
-
Vector typeMammalian Expression, Lentiviral ; Inducible Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFosl1
-
Alt nameFra1
-
Alt namefos-like antigen 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)822
-
Entrez GeneFosl1 (a.k.a. Fra1, fra-1)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCATAGAAGACACCGGGACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pInducer-FRA1 was a gift from Günter Schneider (Addgene plasmid # 192267 ; http://n2t.net/addgene:192267 ; RRID:Addgene_192267) -
For your References section:
AP1/Fra1 confers resistance to MAPK cascade inhibition in pancreatic cancer. Schneeweis C, Diersch S, Hassan Z, Krauss L, Schneider C, Lucarelli D, Falcomata C, Steiger K, Ollinger R, Kramer OH, Arlt A, Grade M, Schmidt-Supprian M, Hessmann E, Wirth M, Rad R, Reichert M, Saur D, Schneider G. Cell Mol Life Sci. 2022 Dec 19;80(1):12. doi: 10.1007/s00018-022-04638-y. 10.1007/s00018-022-04638-y PubMed 36534167